Aspergillus westerdijkiae is a new species of fungus that was recently dismembered from Aspergillus ochraceus taxon. Most isolates of A. westerdijkiae are able to produce large amounts of a mycotoxin called ochratoxin A (OA). OA has been found in food and beverages, such as coffee. A. westerdijkiae is very similar to A. ochraceus, and several isolates previously identified as A. ochraceus are now identified as A. westerdijkiae. By using sequences of the beta-tubulin gene, we analyzed several isolates from Brazilian coffee bean samples, previously identified as A. ochraceus, to compare with those of A. westerdijkiae. In fact, most (84%) were identified as A. westerdijkiae. Since this species consistently produces large amounts of OA, we developed a specific primer-pair for detecting and quantifying it in coffee beans by using real-time PCR. The primers Bt2Aw-F 5'TGATACCTTGGCGCTTGTGACG and Bt2Aw-R 5'CGGAAGCCTAAAAAATGAAGAG provided an amplicon of 347 bp in all A. westerdijkiae isolates, and no cross-reaction was observed using DNA from A. ochraceus. The sensitivity of real-time PCR was more than 100 times higher than the cfu technique.